|   | listor | 
Please help by correcting and extending the Wiki pages.
listor reads in two sets of sequences (typically specified as list files) and writes out a list file that result from the logical union of the two sets. A list file is a file with a list of Uniform Sequence Addresses (USAs), for example, a list of file names. When comparing sequences from the input sets, no use is made of the ID name or accession number; only the sequence itself is compared. The comparison of the sequences is case-independent. The logical union is an OR operation by default. Other available operations are: AND, XOR and NOT.
All the input sequences are kept in memory while the logical unions of the two input sets of sequences is calculated. listor is therefore restricted by the available memory.
Write the logical OR of two lists:
| % listor ../data/file2 Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: | 
Go to the input files for this example
Go to the output files for this example
Example 2
Write the logical AND of two lists:
| % listor ../data/file2 -operator and Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: | 
Go to the output files for this example
Example 3
Write the logical XOR of two lists:
| % listor ../data/file2 -operator xor Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: | 
Go to the output files for this example
Example 4
Write the logical NOT of two lists:
| % listor ../data/file2 -operator not Write a list file of the logical OR of two sets of sequences List of USAs output file [file1.list]: | 
Go to the output files for this example
| 
Write a list file of the logical OR of two sets of sequences
Version: EMBOSS:6.6.0.0
   Standard (Mandatory) qualifiers:
  [-firstsequences]    seqset     Sequence set filename and optional format,
                                  or reference (input USA)
  [-secondsequences]   seqset     Sequence set filename and optional format,
                                  or reference (input USA)
  [-outfile]           outfile    [*.listor] The list of sequence names will
                                  be written to this list file
   Additional (Optional) qualifiers:
   -operator           menu       [OR] The following logical operators combine
                                  the sequences in the following ways:
                                  OR - gives all that occur in one set or the
                                  other
                                  AND - gives only those which occur in both
                                  sets
                                  XOR - gives those which only occur in one
                                  set or the other, but not in both
                                  NOT - gives those which occur in the first
                                  set except for those that also occur in the
                                  second (Values: OR (OR - merger of both
                                  sets); AND (AND - only those in both sets);
                                  XOR (XOR - only those not in both sets); NOT
                                  (NOT - those of the first set that are not
                                  in the second))
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:
   "-firstsequences" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name
   "-secondsequences" associated qualifiers
   -sbegin2            integer    Start of each sequence to be used
   -send2              integer    End of each sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -scircular2         boolean    Sequence is circular
   -squick2            boolean    Read id and sequence only
   -sformat2           string     Input sequence format
   -iquery2            string     Input query fields or ID list
   -ioffset2           integer    Input start position offset
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name
   "-outfile" associated qualifiers
   -odirectory3        string     Output directory
   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit
 | 
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-firstsequences] (Parameter 1) | seqset | Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-secondsequences] (Parameter 2) | seqset | Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 3) | outfile | The list of sequence names will be written to this list file | Output file | <*>.listor | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| -operator | list | The following logical operators combine the sequences in the following ways: OR - gives all that occur in one set or the other AND - gives only those which occur in both sets XOR - gives those which only occur in one set or the other, but not in both NOT - gives those which occur in the first set except for those that also occur in the second | 
 | OR | ||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Associated qualifiers | ||||||||||||
| "-firstsequences" associated seqset qualifiers | ||||||||||||
| -sbegin1 -sbegin_firstsequences | integer | Start of each sequence to be used | Any integer value | 0 | ||||||||
| -send1 -send_firstsequences | integer | End of each sequence to be used | Any integer value | 0 | ||||||||
| -sreverse1 -sreverse_firstsequences | boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask1 -sask_firstsequences | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide1 -snucleotide_firstsequences | boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein1 -sprotein_firstsequences | boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower1 -slower_firstsequences | boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper1 -supper_firstsequences | boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -scircular1 -scircular_firstsequences | boolean | Sequence is circular | Boolean value Yes/No | N | ||||||||
| -squick1 -squick_firstsequences | boolean | Read id and sequence only | Boolean value Yes/No | N | ||||||||
| -sformat1 -sformat_firstsequences | string | Input sequence format | Any string | |||||||||
| -iquery1 -iquery_firstsequences | string | Input query fields or ID list | Any string | |||||||||
| -ioffset1 -ioffset_firstsequences | integer | Input start position offset | Any integer value | 0 | ||||||||
| -sdbname1 -sdbname_firstsequences | string | Database name | Any string | |||||||||
| -sid1 -sid_firstsequences | string | Entryname | Any string | |||||||||
| -ufo1 -ufo_firstsequences | string | UFO features | Any string | |||||||||
| -fformat1 -fformat_firstsequences | string | Features format | Any string | |||||||||
| -fopenfile1 -fopenfile_firstsequences | string | Features file name | Any string | |||||||||
| "-secondsequences" associated seqset qualifiers | ||||||||||||
| -sbegin2 -sbegin_secondsequences | integer | Start of each sequence to be used | Any integer value | 0 | ||||||||
| -send2 -send_secondsequences | integer | End of each sequence to be used | Any integer value | 0 | ||||||||
| -sreverse2 -sreverse_secondsequences | boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask2 -sask_secondsequences | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide2 -snucleotide_secondsequences | boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein2 -sprotein_secondsequences | boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower2 -slower_secondsequences | boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper2 -supper_secondsequences | boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -scircular2 -scircular_secondsequences | boolean | Sequence is circular | Boolean value Yes/No | N | ||||||||
| -squick2 -squick_secondsequences | boolean | Read id and sequence only | Boolean value Yes/No | N | ||||||||
| -sformat2 -sformat_secondsequences | string | Input sequence format | Any string | |||||||||
| -iquery2 -iquery_secondsequences | string | Input query fields or ID list | Any string | |||||||||
| -ioffset2 -ioffset_secondsequences | integer | Input start position offset | Any integer value | 0 | ||||||||
| -sdbname2 -sdbname_secondsequences | string | Database name | Any string | |||||||||
| -sid2 -sid_secondsequences | string | Entryname | Any string | |||||||||
| -ufo2 -ufo_secondsequences | string | UFO features | Any string | |||||||||
| -fformat2 -fformat_secondsequences | string | Features format | Any string | |||||||||
| -fopenfile2 -fopenfile_secondsequences | string | Features file name | Any string | |||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||
| -odirectory3 -odirectory_outfile | string | Output directory | Any string | |||||||||
| General qualifiers | ||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||
| >one tagctagcg >two tagctagcggctacgt >three tagctattttatgctacgtcagtgac | 
| >two tagctagcggctacgt >three tagctattttatgctacgtcagtgac >four gcgcggcgcgcgtgcgtcgttgctggggccc | 
The order that the USAs are written out is not necessarily the same as the order of either of the input sets of sequences.
The results of the four types of logical union follows. Note that the duplicated sequences in these two files have been given the same name. This is not necessary for the operation of listor as it compares the sequences themselves, not the ID names of the sequences.
| fasta::../../data/file1:one fasta::../../data/file1:two fasta::../../data/file1:three fasta::../../data/file2:four | 
| fasta::../../data/file1:two fasta::../../data/file1:three | 
| fasta::../../data/file1:one fasta::../../data/file2:four | 
| fasta::../../data/file1:one | 
The inputs can be any valid USA but typically reference a list file. Some other reference such as a wildcarded database entries or file name are equally valid.
The (default) logical OR of the two sets of sequences is simply the result of merging the two sets of sequences. A sequences appearing in both input sets is referenced once only in the output file. A logical AND simply lists those sequences that occur in both sets of sequences.
A logical XOR lists those sequences that ONLY occur in the first set or only occur in the second set - sequences occuring in both sets are omitted (the opposite of an AND).
A logical NOT lists all those sequences in the first set except for those that also occur in the second set.
listor is restricted by the available memory. Doing logical unions involving all of the sequences in large databases, such as EMBL, is probably impractical unless you are lucky enough to have extraordinary amounts of memory on your machine.
| Program name | Description | 
|---|---|
| aligncopy | Read and write alignments | 
| aligncopypair | Read and write pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| cutseq | Remove a section from a sequence | 
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieve sequence entries from flatfile databases and files | 
| extractalign | Extract regions from a sequence alignment | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Read and write a feature table | 
| featmerge | Merge two overlapping feature tables | 
| featreport | Read and write a feature table | 
| feattext | Return a feature table original text | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Mask all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| nospace | Remove whitespace from an ASCII text file | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| nthseqset | Read and write (return) one set of sequences from many | 
| pasteseq | Insert one sequence into another | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqcount | Read and count sequences | 
| seqret | Read and write (return) sequences | 
| seqretsetall | Read and write (return) many sets of sequences | 
| seqretsplit | Read sequences and write them to individual files | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Read and write (return) sequences, skipping first few | 
| splitsource | Split sequence(s) into original source sequences | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| union | Concatenate multiple sequences into a single sequence | 
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) | 
| yank | Add a sequence reference (a full USA) to a list file | 
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.